Knowledge base

Sushi bag draws Manhattan map

Introduction

The Manhattan chart can display the values of regions on multiple chromosomes. You can use the plotManhattan of the Sushi package.

Code explanation

Input
  • bed format data frame
head(Sushi_GWAS.bed)

 Structure are as follows

 chr.hg18 pos.hg18 pos.hg18.1 rsid pval.GC.DBP V6
 chr1 1695996 1695996 rs6603811 0.003110 .
 chr1 1696020 1696020 rs7531583 0.000824 .
 chr1 1698661 1698661 rs12044597 0.001280 .
 chr1 1711339 1711339 rs2272908 0.001510 .
 chr1 1712792 1712792 rs3737628 0.001490 .
 chr1 1736016 1736016 rs12408690 0.004000 
 chr11 2286805 2286832 GGTGAGGGCCAGCAGCTCCCTGGGGGG 250 1
  • Genome length data frame
    head(Sushi_hg18_genome)

 The structure is as follows

    V1 V2
 chr1 247249719
 chr10 135374737
 chr11 134452384
 chr12 132349534
 chr13 114142980
 chr14 106368585
Code example
library('Sushi')  # Load Sushi package

Sushi_data = data(package ='Sushi') # List Sushi ownn data
data(list = Sushi_data$results[,3]) # Load ata

plotManhattan(bedfile=Sushi_GWAS.bed,pvalues=Sushi_GWAS.bed[,5],
col=SushiColors(6),genome=Sushi_hg18_genome,cex=0.75)

labelgenome(genome=Sushi_hg18_genome,n=4,scale="Mb",
edgeblankfraction=0.20,cex.axis=.5)  #Add genome coordinate position

axis(side=2,las=2,tcl=.2)  # Add a coordinate axis, here is the y axis

mtext("log10(P)",side=2,line=1.75,cex=1,font=2) # add tag
mtext("chromosome",side=1,line=1.75,cex=1,font=2)

Reference

https://www.bioconductor.org/packages/release/bioc/vignettes/Sushi/inst/doc/Sushi.pdf

Leave a Reply

Your email address will not be published. Required fields are marked *

Close Bitnami banner
Bitnami